兽研Advance Publication
The Journal of Veterinary Medical Science
Accepted Date: 9 October 2026 J-STAGE Advance Published Date: 21 October 2026
©2026 The Japanese Society of Veterinary Science Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.
Field: Bacteriology Type of paper: Full paper
Antimicrobial resistance and chlorhexidine susceptibility in canine staphylococcal isolates from dogs with pyoderma and clinically healthy dogs
Running head: CHLORHEXIDINE IN CANINE STAPHYLOCOCCI
Min-Sun Kim 1) , Jung-Hun Kang 1,2) , Ji Hyun Lim 3) , Soo-Jin Yang 3)* and Cheol-Yong Hwang 1)*
1) Laboratory of Veterinary Dermatology, Department of Veterinary Clinical Sciences, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 08826, Korea 2) ORIGIN Veterinary Dermatology Clinic, Busan 48280, Korea 3) Department of Veterinary Microbiology, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 08826, Korea
*Co-corresponding author: Cheol-Yong Hwang, E-mail: cyhwang@snu.ac.kr, Soo-Jin Yang, Email: soojinjj@snu.ac.kr
ABSTRACT Staphylococci, particularly Staphylococcus pseudintermedius, are the major pathogens of canine pyoderma. Meanwhile, the emergence of antimicrobial resistance has become a global concern. Chlorhexidine digluconate is widely used antiseptic in veterinary medicine; however, recent studies on chlorhexidine susceptibility in veterinary staphylococci remain limited. This study evaluated the antimicrobial resistance, chlorhexidine digluconate susceptibility, and presence of antiseptic resistanceassociated genes (qacA/B, qacG, and smr) in staphylococcal isolates from dogs with pyoderma and clinically healthy dogs in Korea. In total, 145 staphylococcal isolates were obtained, including S. pseudintermedius and S. schleiferi. Antimicrobial susceptibility was evaluated using the disk diffusion. Chlorhexidine digluconate susceptibility was determined using the microdilution, qacA/B and smr were detected using real-time PCR, and qacG was detected using conventional PCR. Of the 145 isolates, 93 (64.1%) were classified as multidrug-resistant (MDR). Chlorhexidine digluconate minimum inhibitory concentrations (MICs) ranged from 0.25 to 2 μg/mL, with no significant difference between MDR and non-MDR isolates. qacA/B, qacG, and smr were detected in 4, 13, and 10 isolates, respectively. Isolates carrying both qacA/B and smr showed relatively higher MICs; however, the number of positive isolates was small, and single-gene carriage was not clearly associated with increased MICs. Overall, the chlorhexidine digluconate MICs were substantially lower than the clinical concentrations, and antiseptic resistance-associated genes were detected at low frequencies. Despite the high frequency of MDR isolates, chlorhexidine digluconate remains a useful antiseptic option, although continuous monitoring of reduced susceptibility and antiseptic resistance-associated genes is warranted. KEYWORDS: antimicrobial resistance, canine pyoderma, chlorhexidine digluconate, qac genes, staphylococci
INTRODUCTION Staphylococcus pseudintermedius, a coagulase-positive staphylococcus spp., is the leading pathogen that causes skin infections in dogs and is commonly associated with recurrent skin infections that require long-term antibiotic treatment [2, 14]. Staphylococcus schleiferi has also been reported to be an opportunistic pathogen associated with canine skin infections [15]. In recent decades, the isolation of multidrug-resistant (MDR) staphylococci has increased [12, 26]. Because canine pyoderma frequently leads to antimicrobial prescribing, the increasing prevalence of antimicrobial-resistant staphylococci has limited systemic antimicrobial options and emphasized the importance of topical antimicrobial therapy as part of antimicrobial stewardship [9, 15]. In veterinary medicine, topical treatments with chlorhexidine digluconate are widely used in the form of sprays and shampoos for canine pyoderma and are recommended as alternatives to systemic treatments [16]. Chlorhexidine digluconate, a broad-spectrum antiseptic, acts as a cationic agent that binds to negatively charged bacterial cell walls. This disrupts the bacterial cell wall and causes cytoplasmic precipitation [3]. Topical agents have several advantages, including rapid improvement of skin lesions and reduced duration of systemic antibiotic therapy [9, 16]. However, the increased use of chlorhexidine has raised concerns regarding the emergence of strains with reduced susceptibility, mediated by quaternary ammonium compound (qac) genes [20, 22, 30]. These genes encode bacterial efflux pumps that reduce the intracellular accumulation of various antiseptic compounds, including chlorhexidine digluconate, and may contribute to decreased susceptibility. In staphylococci, qacA/B encode efflux pumps belonging to the major facilitator superfamily, whereas qacG and smr (qacC) encode small multidrug resistance family efflux pumps [20, 22, 30]. From a clinical perspective, chlorhexidine digluconate is widely used to manage canine pyoderma. When the treatment response is suboptimal, clinicians may question whether reduced susceptibility to chlorhexidine contributes to treatment failure. However, the current evidence base is limited, particularly for veterinary isolates from Asia. The reported prevalence of qac genes in canine staphylococci has varied by country, sampling period,
isolate origin, and bacterial species [7, 17, 25, 29, 31]. In Japan, studies of isolates from dogs with superficial pyoderma collected in 2009-2010 and 2023 detected no qacA/B, whereas smr was detected in 1.0% of isolates in the latter study [17, 25]. In canine clinical isolates collected in Finland, Germany, the United Kingdom, and the United States during 2005-2016, the reported prevalences of qacA/B and smr ranged from 0.0% to 4.0% [7]. In contrast, a Canada/USA study of clinical infection or colonization isolates collected during 2005-2012 reported qacA/B, qacG, and smr in 30.0%, 37.1%, and 50.0% of isolates, respectively [29]. An Australian study of clinical veterinary and pyoderma associated isolates collected in 1999-2002 and 2013-2014 detected qacA/B, qacG, and smr in 1.6%, 6.4%, and 2.4% of isolates, respectively [31]. However, recent data remain scarce, particularly in Asia [17, 25]. Accordingly, updated regional surveillance is necessary to detect potential changes in susceptibility and the emergence of resistance-associated determinants. Therefore, this study aimed to evaluate antimicrobial resistance, chlorhexidine digluconate susceptibility, and the presence of qacA/B, qacG, and smr genes in staphylococcal isolates from dogs with pyoderma and clinically healthy dogs in Korea.
MATERIALS AND METHODS Bacterial isolates In total, 145 staphylococcal isolates were collected from client-owned dogs in Korea between 2017 and 2023, and one isolate was obtained from each dog. These isolates were obtained from 128 dogs with pyoderma and 17 clinically healthy dogs that presented at the Seoul National University Veterinary Medical Teaching Hospital. Pyoderma was diagnosed based on clinical signs and cytological examination. Samples from dogs with pyoderma were collected from the skin lesion sites, whereas samples from healthy dogs were obtained from clinically normal skin without dermatological lesions in the inguinal region. Samples in individual collection tubes were stored at 4°C and transported to the laboratory using Amies transport medium (Yuhan Labtech, Seoul, Korea). Each swab was directly streaked on blood agar plates (Hangang, Gyeonggi, Korea) and incubated aerobically for 18–24 hr at 37°C. Staphylococcal isolates were initially identified based on colony morphology and confirmed by
matrix-assisted laser desorption ionization-time of flight (MALDI-TOF MS; Bruker Daltonics, Bremen, Germany) according to the manufacturer’s protein extraction protocol [18]. Staphylococcus pseudintermedius isolates were confirmed by polymerase chain reaction (PCR) using species-specific primers (Supplementary Table 1) [21]. The bacterial stock cultures were stored in tryptic soy broth (TSB; Thermo Fischer Scientific Oxoid Ltd., Basingstoke, UK) with 50% glycerol at −80°C before further studies.
Antimicrobial susceptibility test Antimicrobial susceptibility of the staphylococcal isolates was determined using the agar disk diffusion method. The following antibiotics were tested: penicillin (10 units), oxacillin (1 μg), gentamicin (10 μg), clindamycin (2 μg), tetracycline (30 μg), ciprofloxacin (5 μg), trimethoprimsulfamethoxazole (1.25/23.75 μg), and chloramphenicol (30 μg) (Thermo Fisher Scientific Oxoid Ltd.). Cefoxitin (30 μg) disk diffusion testing was additionally used for methicillin resistance interpretation in staphylococcal species for which oxacillin disk diffusion criteria were not applicable. Results were interpreted according to the criteria of the Clinical and Laboratory Standards Institute (CLSI) criteria [5, 6]. Multidrug resistance was defined as non-susceptibility to at least one agent in three or more antimicrobial classes. S. aureus ATCC 25923 was used as the quality control strain for disk diffusion testing.
Determination of the minimum inhibitory concentration of chlorhexidine using a microdilution method The minimum inhibitory concentration (MIC) of chlorhexidine was determined in triplicate using a microdilution method, according to the CLSI guidelines [6]. Mueller–Hinton Broth (MHB; BD Diagnostic Systems, Sparks, MD, USA) was supplemented with 2-fold dilution series (from 0.0625 to 32 μg/mL) chlorhexidine digluconate (Sigma-Aldrich, St Louis, MO, USA). The isolates were suspended in TSB, and the density was standardized to 0.5 McFarland using a
turbidimeter (Densichek McFarland densitometer; bioMérieux, Lyon, France). Bacterial suspensions were inoculated into wells containing serial twofold dilutions of chlorhexidine digluconate in MHB and aerobically incubated for 18–24 hr at 37°C.
Isolation of DNA Bacterial DNA was extracted using the InstaGene Matrix (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Briefly, a single colony incubated on a blood agar plate at 37°C for 18–24 hr was suspended in autoclaved distilled water in a microfuge tube. After centrifugation, the supernatant was removed, and 200 μL of the InstaGene Matrix was added to the pellet. The mixture was incubated at 56°C for 15–30 min, vortexed, and then heated in boiling water for 8 min. After a second vortexing and centrifugation step, the supernatant was collected and stored at −20°C until use in PCR.
Detection of antiseptic resistance-associated genes (qacA/B, qacG, smr) The presence of qacA/B and smr was examined by real-time PCR using an Exicycler 96 Real-Time Quantitative Thermal Block (Bioneer, Daejeon, Korea), whereas the presence of qacG was screened by conventional PCR. The primers used in this study are listed in Supplementary Table 1 [21, 30]. PCR amplification was performed with an initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 10 sec, 53°C for 10 sec, and 72°C for 25 sec [29]. The PCR mixture for real-time PCR comprised 25 μL AccuPower® 2X GreenStar qPCR Master mix (Bioneer), 20 μL of deionized sterile water, 3 μL each of forward and reverse primers, and 2 μL of gDNA. To further characterize the qacA/B- positive isolates and assess sequence variation potentially associated with chlorhexidine susceptibility, the qacA/B PCR products were subjected to Sanger sequencing [1]. The obtained nucleotide sequences and deduced amino acid sequences were compared with the reference qacA sequence (GenBank accession number AB566410), and the reference qacB sequence (GenBank accession number AF053772) [1]. For qacG, PCR products were analyzed by agarose gel electrophoresis, and isolates showing an amplicon of the expected size (275 bp) were considered presumptively positive. To confirm the identity
of the qacG amplicons, all qacG-positive PCR products were subjected to Sanger sequencing.
Multilocus sequence typing (MLST) MLST was performed on 24 isolates carrying qacA/B, qacG, and/or smr to characterize the genetic backgrounds of the antiseptic resistance-associated gene-positive isolates. Alleles and sequence types were assigned according to the corresponding species-specific MLST schemes and databases for S. pseudintermedius, S. epidermidis, and S. hominis [23, 24, 32]. For the S. capitis isolate, a sequence type could not be determined because an applicable species-specific MLST scheme was not available.
Statistical analysis The Shapiro–Wilk test was used to assess data normality. The relationship between the presence of qac genes and MIC was evaluated using the Mann–Whitney U test. Comparisons of MIC values according to multidrug resistance status and clinical status were also performed using the Mann– Whitney U test. Associations between categorical variables, including the presence of qacA/B, qacG, and smr genes and multidrug resistance or clinical status, were analyzed using Fisher’s exact test. All statistical analyses were performed using SPSS (version 20.0; IBM Corp., Armonk, NY, USA) and R software version 4.0.2 (The R Foundation for Statistical Computing, Vienna, Austria). P < 0.05 was considered statistically significant.
RESULTS Bacterial identification A total of 145 staphylococcal isolates were included in this study, including 128 from dogs with pyoderma and 17 from clinically healthy dogs (Table 1). Among the pyoderma isolates, S. pseudintermedius was predominant (100/128, 78.1%), followed by S. schleiferi (28/128, 21.9%). In contrast, isolates from clinically healthy dogs showed greater species diversity, comprising six
staphylococcal species, with S. pseudintermedius being the most frequently identified.
Antimicrobial resistance profiles A total of 93 isolates (64.1%) were classified as MDR, and the antimicrobial susceptibility profiles of all 145 isolates are shown in Supplementary Table 2. Overall, resistance was most frequently observed against penicillin (84.1%), followed by tetracycline (67.6%), methicillin resistance based on oxacillin or cefoxitin (64.1%), ciprofloxacin (48.3%), trimethoprim-sulfamethoxazole (48.3%), clindamycin (41.4%), chloramphenicol (37.2%), and gentamicin (22.1%). The species-specific resistance profiles, including susceptible, intermediate, and resistant categories, of all S. pseudintermedius (n=106) and S. schleiferi (n=29) isolates are summarized in Fig. 1. The proportion of resistant isolates appeared to be higher in S. pseudintermedius than in S. schleiferi (Fig. 1A and 1B). This tendency was most apparent for gentamicin, clindamycin, tetracycline, trimethoprim-sulfamethoxazole, and chloramphenicol, whereas resistance to penicillin, oxacillin, and ciprofloxacin was observed in both species. Consistently, the number of antimicrobials to which isolates were resistant tended to be higher in S. pseudintermedius than in S. schleiferi (Fig 1C). Among the 106 S. pseudintermedius isolates, 89 (84.0%) were classified as MDR, whereas none of the 29 S. schleiferi isolates were classified as MDR. The remaining four MDR isolates belonged to other staphylococcal species. The overlap between methicillin resistance and MDR among S. pseudintermedius and S. schleiferi isolates is shown in Table 2. Among the 106 S. pseudintermedius isolates, 73/106 (68.9%) were classified as MRSP and 33/106 (31.1%) as MSSP. MDR was observed in 68/73 (93.2%) MRSP isolates and 21/33 (63.6%) MSSP isolates, with the MDR results for pyoderma and healthy isolates presented separately in Table 2. Among the S. schleiferi isolates, 14/29 (48.3%) were classified as MRSS and 15/29 (51.7%) as MSSS.
Chlorhexidine digluconate MIC distribution The MICs of chlorhexidine digluconate for all 145 staphylococcal isolates ranged from 0.25 to 2 μg/mL. The distribution of chlorhexidine digluconate MICs according to qacA/B, qacG, and smr gene
profiles is shown in Table 3. In S. pseudintermedius, 104 of 106 isolates (98.1%) had MICs of 0.5 μg/mL and 1 μg/mL, with 83 isolates showing an MIC of 0.5 μg/mL and 21 isolates showing an MIC of 1μg/mL. In S. schleiferi, 28 of 29 isolates (96.6%) had MICs of 0.5 μg/mL and 1 μg/mL, with 13 and 15 isolates showing MICs of 0.5 and 1 μg/mL, respectively. Statistical analysis revealed no significant difference in the chlorhexidine digluconate MIC distribution between the MDR and non-MDR isolates (P > 0.05).
Detection of qacA/B, qacG, and smr genes and chlorhexidine digluconate MICs Antiseptic resistance-associated genes, including qacA/B, qacG, and smr, were detected in a subset of isolates (Table 3). Overall, qacA/B, qacG, and smr were detected in 4, 13, 10 isolates, respectively. The identity of all qacG-positive amplicons was confirmed by Sanger sequencing. Among S. pseudintermedius isolates from dogs with pyoderma, qacA/B, qacG, and smr were detected in 1, 11, 3 isolates, respectively. One isolate carrying both qacA/B and smr exhibited a chlorhexidine digluconate MIC of 2 μg/mL, whereas the two isolates carrying smr alone showed MICs of 0.5 μg/mL. The 11 qacG- positive clinical S. pseudintermedius isolates showed MICs of 0.5 μg/mL and were negative for both qacA/B and smr. None of the S. schleiferi isolates carried qacA/B, qacG, or smr. Among the isolates obtained from clinically healthy dogs, qacA/B, qacG, and/or smr were detected in several staphylococcal isolates. Among S. pseudintermedius isolates from clinically healthy dogs, qacG was detected in two isolates, with MICs of 0.5 and 1 μg/mL. Both qacA/B and smr were detected in one S. epidermidis isolate and one S. capitis isolate, with MICs of 2 μg/mL and 1 μg/mL, respectively. One S. hominis isolate carrying qacA/B alone had a MIC of 0.5 μg/mL. In addition, smr alone was detected in four S. epidermidis isolates and one S. hominis isolate, with MICs ranging from 0.5 to 1 μg/mL. Overall, qacA/B, qacG, and smr were detected in 4/145 (2.8%), 13/145 (9.0%), and 10/145 (6.9%) isolates, respectively. All qacG-positive isolates were S. pseudintermedius and were negative for both qacA/B and smr. Isolates carrying both qacA/B and smr showed chlorhexidine digluconate MICs of 1 or 2 μg/mL, whereas isolates carrying only one of these genes or qacG showed MIC values that overlapped
with those of gene-negative isolates. Chlorhexidine digluconate MICs did not differ significantly between qacG-positive and qacG-negative isolates (P > 0.05).
Characteristics of antiseptic resistance-associated gene-positive staphylococcal isolates The characteristics of the qacA/B-, qacG-, and/or smr-positive isolates are summarized in Table 4. A total of 24 isolates carrying qacA/B, qacG, and/or smr were analyzed using MLST, including 16 S. pseudintermedius, five S. epidermidis, two S. hominis, and one S. capitis isolate. The sequence type of the S. capitis isolate could not be determined because allele and sequence type assignments could not be performed using the MLST schemes applied in this study. Among the 16 S. pseudintermedius isolates, one isolate carrying both qacA/B and smr was assigned to ST361, whereas two isolates carrying smr alone were assigned to ST1402 and ST496. Among the 13 qacG-positive S. pseudintermedius isolates, ST2769 was identified in three isolates, whereas ST366, ST733, ST2285, ST2227, ST1341, ST794, and ST25 were each identified in one isolate; three isolates were non-typeable. Among five S. epidermidis isolates from clinically healthy dogs, four were assigned to ST35, ST5, ST130, and ST54, whereas one isolate was non-typeable. One S. epidermidis isolate assigned to ST130 carried both qacA/B and smr, whereas the remaining four isolates carried smr alone. Both S. hominis isolates were non-typeable. Sanger sequencing of the four qacA/B-positive isolates confirmed qacA in all isolates. Amino acid substitutions were identified in two isolates. The S. capitis isolate harbored A25S, V148L, A152V, A291T, and M380T, whereas the S. epidermidis isolate harbored A152V, E169D, A184T, A291T, and M380T. The amino acid substitutions characteristic of the qacA4 allele were not detected [1].
DISCUSSION Antimicrobial resistance is a growing challenge in veterinary medicine worldwide [12, 26]. In this study, 93 of the 145 staphylococcal isolates (64.1%) were classified as MDR, indicating that antimicrobial resistance was common among canine skin-associated staphylococci in Korea. High rates of multidrug resistance have also been reported among canine MRSP isolates in Korea; in a previous study, 58 of 60 MRSP isolates (96.7%) from dogs with pyoderma and otitis externa were classified as MDR [8]. Together, these findings underscore the importance of monitoring multidrug-resistant staphylococci associated with canine skin infections. As systemic antimicrobial options have become increasingly limited owing to acquired resistance, topical antiseptic-based treatments have become an important component of managing canine bacterial skin infections. Chlorhexidine digluconate is one of the most frequently used antiseptics in veterinary medicine [9, 16]. The increasing use of chlorhexidine digluconate has raised concerns regarding the emergence of reduced susceptibility to antiseptics in staphylococcal species [22, 33]. In staphylococci, qac genes encode multidrug efflux pumps and have been implicated in reduced susceptibility to chlorhexidine and other antiseptic agents [30]. Previous studies have reported variable prevalence rates of qacA/B, smr, and related qac genes in canine staphylococcal isolates across different geographical regions, including Japan, Germany, Finland, the United Kingdom, the United States, Canada, and Australia [7, 17, 25, 29, 31]. These reported rates vary widely according to country, study period, staphylococcal species and target genes examined. In the present study, qacA/B, qacG, and smr were detected in 4/145 (2.8%), 13/145 (9.0%), and 10/145 (6.9%), respectively, not only in clinical isolates but also identified in staphylococcal isolates from healthy skin. These findings suggest that antiseptic resistance-associated genes may be present in both pathogenic and commensal skin staphylococci, although their significance remains unclear. MLST analysis showed that isolates carrying antiseptic resistance-associated genes belonged to several STs rather than a single ST. In S. pseudintermedius, qacA/B- and/or smr-positive isolates belonged to ST361, ST1402, and ST496. Among these, ST361 has previously been reported in a canine pyoderma-associated MRSP isolate in Korea [8]. In a previous Australian study, ST496 was also
reported among MRSP isolates, and qac genes were detected in several MRSP STs, with ST71 MRSP being significantly more likely to harbor qac genes than other MRSP clones [31]. Similarly, the qacG- positive S. pseudintermedius isolates in the present study belonged to diverse STs, indicating that qacG carriage was not restricted to a single sequence type. However, because MLST was performed only for isolates carrying the investigated antiseptic resistance-associated genes, the present study cannot determine whether particular STs are associated with qac gene carriage or represent common pyodermarelated lineages or clonal dissemination in Korea. Therefore, the MLST results should be interpreted descriptively. Currently, there are no established chlorhexidine digluconate resistance breakpoints according to the CLSI guidelines. Previous studies have reported MICs for chlorhexidine digluconate in the range of 1– 8 μg/mL [4, 17, 27], whereas those in this study ranged from 0.25 to 2 μg/mL. This relatively narrow and low MIC range suggests that chlorhexidine susceptibility remains high among canine skinassociated staphylococci in this study population. In addition, chlorhexidine digluconate MIC distributions did not differ significantly between MDR and non-MDR isolates, indicating that multidrug resistance to systemic antimicrobials was not clearly associated with reduced chlorhexidine susceptibility in this collection. Although qacA/B, qacG, and smr were detected in this study, no consistent relationship was observed between antiseptic resistance-associated gene carriage and the MIC of chlorhexidine digluconate. Isolates carrying both qacA/B and smr showed relatively higher MICs of 1 or 2 μg/mL; however, the number of isolates carrying both genes was too small to determine whether combined gene carriage was associated with increased chlorhexidine MIC. In addition, although qacG has previously been associated with elevated chlorhexidine digluconate MICs in canine S. pseudintermedius, such an association was not observed in the present study [29]. Previous studies have shown inconsistent associations between antiseptic resistance-associated genes and chlorhexidine susceptibility [7, 11, 13, 19, 28, 29, 31]. Some studies have reported elevated chlorhexidine MICs among qacA/B-positive isolates, including S. aureus and S. epidermidis, supporting the potential role of these genes in reducing susceptibility [19, 28]. In contrast, other studies on S. aureus
and S. pseudintermedius have shown that the presence of qacA/B, smr, or other qac genes does not necessarily correspond to increased chlorhexidine MICs [7, 11, 13, 29, 31]. These discrepancies suggest that the detection of qac genes alone might be insufficient to predict phenotypic susceptibility to chlorhexidine digluconate. In addition to gene carriage, allelic variation within qacA may influence chlorhexidine susceptibility. One study identified a novel qacA allele, qacA4, encoding two amino acid substitutions and demonstrated that qacA4 carriage was associated with elevated chlorhexidine MICs in S. epidermidis [1]. Although the substitutions characteristic of qacA4 were not detected in the present study, five different amino acid substitutions were identified in two staphylococcal isolates, S. capitis and S. epidermidis. However, the small number of qacA-positive isolates limited further assessment of the relationship between qacA sequence variation and chlorhexidine susceptibility. Functional gene expression, strain-specific regulatory mechanisms, and other genetic or environmental factors may also influence chlorhexidine MIC outcomes [31]. The MICs of chlorhexidine digluconate observed in this study (0.25–2 μg/mL) were substantially lower than the concentrations typically used in commercial medicated shampoos and antiseptic solutions, which generally range from 5,000 to 40,000 μg/mL [9, 16]. These findings support the continued clinical use of chlorhexidine digluconate as an effective topical antiseptic for canine staphylococcal skin infections. However, MIC results should be interpreted cautiously when extrapolating to clinical efficacy. In clinical settings, chlorhexidine is often applied as a shampoo, and the duration of bacterial exposure during shampoo use may be shorter and more variable than that used in in vitro susceptibility testing. In addition, dilution during application, rinsing, organic matter on the skin surface, and owner compliance may influence the actual effectiveness of chlorhexidine-containing topical products. Therefore, the clinical efficacy of chlorhexidine digluconate cannot be predicted solely based on MIC values. Furthermore, as chlorhexidine products are used at relatively high concentrations in clinical practice, their use should be optimized to balance their antimicrobial efficacy and cutaneous tolerability. A recent study suggested that the repeated application of high concentrations may affect skin barrier integrity, highlighting the need for appropriate use in veterinary medicine [10]. This study had several limitations. The number of isolates carrying antiseptic resistance-associated
genes was limited, particularly for qacA/B and smr, which restricted the statistical assessment of associations among gene carriage, sequence type, and chlorhexidine digluconate MIC. Furthermore, because MLST was performed only for isolates carrying the investigated antiseptic resistance-associated genes, the MLST results should not be interpreted as representative of the overall clonal distribution of canine skin-associated staphylococci in Korea. The sample size was relatively small, especially for clinically healthy dogs, which resulted in an imbalance between clinical and healthy skin isolates. In addition, all isolates were obtained from a single referral institution, which may limit the generalizability of our findings. Dogs presenting to a veterinary medical teaching hospital may differ from those seen in general practice, particularly with respect to prior exposure to antimicrobial or antiseptic treatments. This referral bias may have influenced the observed antimicrobial resistance profiles. In conclusion, chlorhexidine digluconate MICs were low among staphylococcal isolates from dogs in Korea, and qacA/B, qacG, and smr genes were detected at low frequencies. No clear association was observed between chlorhexidine MICs and carriage of qacA/B, qacG, or smr. These findings suggest that chlorhexidine digluconate remains a useful topical antiseptic option for the management of canine staphylococcal skin infections. Further studies, including larger isolate collections, additional antiseptic resistance-associated genes and genomic analyses of isolates with elevated chlorhexidine MICs, are warranted to clarify the mechanisms underlying reduced susceptibility and monitor potential changes in resistance patterns.
CONFLICT OF INTEREST. The authors have no conflict of interest to declare.
ACKNOWLEDGMENTS. This work was supported by the Research Institute of Veterinary Science, Seoul National University.
REFERENCE 1. Addetia A, Greninger AL, Adler A, Yuan S, Makhsous N, Qin X, Zerr DM. 2019. A novel, widespread qacA allele results in reduced chlorhexidine susceptibility in Staphylococcus epidermidis. Antimicrob Agents Chemother 63:e02607-18. 2. Bannoehr J, Guardabassi L. 2012. Staphylococcus pseudintermedius in the dog: taxonomy, diagnostics, ecology, epidemiology and pathogenicity. Vet Dermatol 23: 253-266. 3. Basrani B. 2005. Chlorhexidine gluconate. Aust Endod J 31: 48-52. 4. Clark SM, Loeffler A, Bond R. 2015. Susceptibility in vitro of canine methicillin-resistant andsusceptible staphylococcal isolates to fusidic acid, chlorhexidine and miconazole: opportunities for topical therapy of canine superficial pyoderma. J Antimicrob Chemother 70: 2048-2052. 5. Clinical and Laboratory Standards Institute. 2020. *Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals*. 5th ed., CLSI document VET01S, Clinical and Laboratory Standards Institute, Wayne. 6. Clinical and Laboratory Standards Institute. 2020. *Performance standards for antimicrobial susceptibility testing; approved standard*. 30th ed., CLSI document M100, Clinical and Laboratory Standards Institute, Wayne. 7. Frosini SM, Bond R, Rantala M, Grönthal T, Rankin SC, O’Shea K, Timofte D, Schmidt V, Lindsay J, Loeffler A. 2019. Genetic resistance determinants to fusidic acid and chlorhexidine in variably susceptible staphylococci from dogs. BMC Microbiol 19: 81-90. 8. Kang JH, Chung TH, Hwang CY. 2017. Clonal distribution of methicillin-resistant Staphylococcus pseudintermedius isolates from skin infection of dogs in Korea. Vet Microbiol 210: 32-37. 9. Loeffler A, Cain CL, Ferrer L, Nishifuji K, Varjonen K, Papich MG, Guardabassi L, Frosini SM, Barker EN, Weese JS. 2025. Antimicrobial use guidelines for canine pyoderma by the International Society for Companion Animal Infectious Diseases (ISCAID). Vet Dermatol 36: 234-282. 10. Matsuda A, Nakamura Y, Itoi T, Arai K, Kutara K, Sugimoto K, Maeta N. 2025. Daily topical
application of chlorhexidine gluconate to the skin in dogs and its impact on skin barriers and cytotoxicity. J Vet Med Sci 87: 257-262. 11. Mc Gann P, Milillo M, Kwak YI, Quintero R, Waterman PE, Lesho E. 2013. Rapid and simultaneous detection of the chlorhexidine and mupirocin resistance genes qacA/B and mupA in clinical isolates of methicillin-resistant Staphylococcus aureus. Diagn Microbiol Infect Dis 77: 270-272. 12. McCarthy AJ, Harrison EM, Stanczak-Mrozek K, Leggett B, Waller A, Holmes MA, et al. 2015. Genomic insights into the rapid emergence and evolution of MDR in Staphylococcus pseudintermedius. J Antimicrob Chemother 70: 997-1007. 13. McDanel JS, Murphy CR, Diekema DJ, Quan V, Kim DS, Peterson EM, Evans KD, Tan GL, Hayden MK, Huang SS. 2013. Chlorhexidine and mupirocin susceptibilities of methicillin-resistant Staphylococcus aureus from colonized nursing home residents. Antimicrob Agents Chemother 57: 552- 558. 14. Miller W. H. Jr, Griffin C. E., Campbell K. L. 2013. Superficial bacterial folliculitis. pp. 184-186. In: Muller and Kirk’s Small Animal Dermatology, 7th ed. (Muller G. H., ed.), Elsevier, St. Louis. 15. Morris DO, Loeffler A, Davis MF, Guardabassi L, Weese JS. 2017. Recommendations for managing meticillin-resistant staphylococcal infections in small animals. Vet Dermatol 28: 304-e69. 16. Mueller RS, Bergvall K, Bensignor E, Bond R. 2012. A review of topical therapy for skin infections with bacteria and yeast. Vet Dermatol 23: 330-e62. 17. Murayama N, Nagata M, Terada Y, Okuaki M, Takemura N, Nakaminami H, Noguchi N. 2013. In vitro antiseptic susceptibilities for Staphylococcus pseudintermedius isolated from canine superficial pyoderma in Japan. Vet Dermatol 24: 126-e29. 18. Nisa S, Bercker C, Midwinter AC, Bruce I, Graham CF, Venter P, Bell A, French NP, Benschop J, Bailey KM, Wilkinson DA. 2019. Combining MALDI-TOF and genomics in the study of methicillin resistant and multidrug resistant Staphylococcus pseudintermedius in New Zealand. Sci Rep 9: 1271.
19. Prag G, Falk-Brynhildsen K, Jacobsson S, Hellmark B, Unemo M, Söderquist B. 2014. Decreased susceptibility to chlorhexidine and prevalence of disinfectant resistance genes among clinical isolates of Staphylococcus epidermidis. APMIS 122: 961-967. 20. Russell AD. 2003. Biocide use and antibiotic resistance: the relevance of laboratory findings to clinical and environmental situations. Lancet Infect Dis 3: 794-803. 21. Sasaki T, Tsubakishita S, Tanaka Y, Sakusabe A, Ohtsuka M, Hirotaki S, Kawakami T, Fukata T, Hiramatsu K. 2010. Multiplex-PCR Method for Species Identification of Coagulase-Positive Staphylococci. J Clin Microbiol 48: 765-769. 22. Smith K, Gemmell CG, Hunter IS. 2007. The association between biocide tolerance and the presence or absence of qac genes among hospital-acquired and community-acquired MRSA isolates. J Antimicrob Chemother 61: 78-84. 23. Solyman SM, Black CC, Duim B, Perreten V, Duijkeren EV, Wagenaar JA, Eberlein LC, Sadeghi LN, Videla R, Bemis DA, Kania SA. 2013. Multilocus sequence typing for characterization of Staphylococcus pseudintermedius. J Clin Microbiol 51: 306-310. 24. Thomas JC, Vargas MR, Miragaia M, Peacock SJ, Archer GL, Enright MC. 2007. Improved multilocus sequence typing scheme for Staphylococcus epidermidis. J clin Microbiol 45: 616-619. 25. Tsunoi M, Takiguchi M, Ashida E, Harada K, Iyori K, Shimizu K. 2025. Antiseptic susceptibility profiles of canine pyoderma-associated staphylococci in Japan: first identification of plasmid-borne smr in Staphylococcus coagulans. Front. Vet. Sci. 12: 1621915. 26. Uri M, Buckley LM, Marriage L, McEwan N, Schmidt VM. 2016. A pilot study comparing in vitro efficacy of topical preparations against veterinary pathogens. Vet Dermatol 27: 152-e39. 27. Valentine BK, Dew W, Yu A, Weese JS. 2012. In vitro evaluation of topical biocide and antimicrobial susceptibility of Staphylococcus pseudintermedius from dogs. Vet Dermatol 23: 493-e95. 28. Van den Poel B, Saegeman V, Schuermans A. 2022. Increasing usage of chlorhexidine in health care settings: blessing or curse? A narrative review of the risk of chlorhexidine resistance and the implications
for infection prevention and control. Eur J Clin Microbiol Infect Dis. 41: 349-362. 29. Walker MA, Singh A, Gibson TW, Rousseau J, Weese JS. 2020. Presence of Qac genes in clinical isolates of methicillin-resistant and methicillin-susceptible Staphylococcus pseudintermedius and their impact on chlorhexidine digluconate susceptibility. Vet Surg 49: 971-976. 30. Wassenaar T, Ussery D, Nielsen L, Ingmer H. 2015. Review and phylogenetic analysis of qac genes that reduce susceptibility to quaternary ammonium compounds in Staphylococcus species. Eur J Microbiol Immunol (Bp) 5: 44-61. 31. Worthing KA, Marcus A, Abraham S, Trott DJ, Norris JM. 2018. Qac genes and biocide tolerance in clinical veterinary methicillin-resistant and methicillin-susceptible Staphylococcus aureus and Staphylococcus pseudintermedius. Vet Microbiol 216: 153-158. 32. Zhang L, Thomas JC, Miragaia M, Bouchami O, Chaves F, d’Azevedo PA, Aanensen DM, Lencastre H, Gray BM, Robinson DA. 2013. Multilocus sequence typing and further genetic characterization of the enigmatic pathogen, Staphylococcus hominis. PLoS One 8: e66496. 33. Zmantar T, Kouidhi B, Miladi H, Bakhrouf A. 2011. Detection of macrolide and disinfectant resistance genes in clinical Staphylococcus aureus and coagulase-negative staphylococci. BMC Res Notes 4: 1-9.
FIGURE LEGENDS
Fig. 1. Antimicrobial resistance profiles of Staphylococcus pseudintermedius and S. schleiferi isolates from canine skin in Korea. Antimicrobial resistance phenotypes of S. pseudintermedius (A) and S. schleiferi (B) isolates. Distribution of the number of antimicrobials with resistance in S. pseudintermedius and S. schleiferi isolates (C). S, susceptible; I, intermediate; R, resistant; PEN, penicillin; OXA, oxacillin; GEN, gentamycin; CLI, clindamycin; TET, tetracycline; CIP, ciprofloxacin; SXT, trimethoprim-sulfamethoxazole; CHL, chloramphenicol.
Table 1. Species distribution of staphylococcal isolates from dogs with pyoderma and clinically healthy dogs Species Pyoderma isolates, n (%) Clinically healthy dog isolates, n (%) Total, n (%) S. pseudintermedius 100 (78.1) 6 (35.3) 106 (73.1) S. schleiferi 28 (21.9) 1 (5.9) 29 (20.0) S. epidermidis 0 (0) 5 (29.4) 5 (3.4) S. hominis 0 (0) 3 (17.6) 3 (2.1) S. capitis 0 (0) 1 (5.9) 1 (0.7) S. pettenkoferi 0 (0) 1 (5.9) 1 (0.7) Total 128 (100.0) 17 (100.0) 145 (100.0)
Table 2. Overlap between methicillin resistance and multidrug resistance among Staphylococcus pseudintermedius and Staphylococcus schleiferi Species Methicillin resistance status Pyoderma isolates, n (%) Healthy isolates, n (%) Total isolates, n (%) MDR Pyoderma isolates, n (%) MDR Healthy isolates, n (%) Total MDR isolates, n (%) S. pseudintermedius MRSP 70/100 (70.0) 3/6 (50.0) 73/106 (68.9) 65/70 (92.9) 3/3 (100.0) 68/73 (93.2) MSSP 30/100 (30.0) 3/6 (50.0) 33/106 (31.1) 19/30 (63.3) 2/3 (66.6) 21/33 (63.6) Total 100/100 (100.0) 6/6 (100.0) 106/106 (100.0) 84/100 (84.0) 5/6 (83.3) 89/106 (84.0) S. schleiferi MRSS 13/28 (46.4) 1/1 (100.0) 14/29 (48.3) 0/13 (0) 0/1 (0) 0/14 (0) MSSS 15/28 (53.6) 0/1 (0) 15/29 (51.7) 0/15 (0) 0/0 (0) 0/15 (0)
Total 28/28 (100.0) 1/1 (100.0) 29/29 (100.0) 0/28 (0) 0/1 (0) 0/29 (0) MRSP, methicillin-resistant S. pseudintermedius; MSSP, methicillin-susceptible S. pseudintermedius; MRSS, methicillin-resistant S. schleiferi; MSSS, methicillinsusceptible S. schleiferi; MDR, multidrug resistance. MDR was defined as non-susceptibility to at least one agent in three or more antimicrobial classes.
Table 3. Distribution of qacA/B, qacG, and smr genes and minimum inhibitory concentrations (MICs) of chlorhexidine digluconate in 145 clinical and healthy skin staphylococcal isolates Group Gene status n Chlorhexidine MIC (μg/mL) 0.25 0.5 1 2 Clinical isolates S. pseudintermedius qacA/B-, qacG-, smr- 86 1 66 19 - qacG+ only 11 - 11 - - smr+ only 2 - 2 - - qacA/B+, smr+ 1 - - - 1 S. schleiferi qacA/B-, qacG-, smr- 28 - 12 15 1 Healthy skin isolates S. pseudintermedius qacA/B-, qacG-, smr- 4 - 3 1 - qacG+ only 2 - 1 1 - S. epidermidis smr+ only 4 - 2 2 - qacA/B+, smr+ 1 - - - 1 S. hominis qacA/B-, qacG-, smr- 1 - 1 - - qacA/B+ only 1 - 1 - - smr+ only 1 - 1 - - S. schleiferi qacA/B-, qacG-, smr- 1 - 1 - - S. capitis qacA/B+, smr+ 1 - - 1 - S. pettenkoferi qacA/B-, qacG-, smr- 1 - - 1 -
Table 4. Characteristics of qacA/B-, qacG-, and/or smr-positive staphylococcal isolates
Species Group AMR profile ST qacA/B qacG smr S. pseudintermedius Pyoderma PEN-TET-SXT-CHL 2769 - + - (n = 16) Pyoderma PEN-OXA-TET-CIP 366 - + -
Pyoderma None NT - + -
Pyoderma PEN-OXA-GEN-TET-CIP-SXT 361 + - +
Pyoderma PEN-OXA-CLI-TET-CIP-SXT 1402 - - +
Pyoderma PEN-OXA-CLI-TET-CIP-SXT-CHL 733 - + -
Pyoderma PEN-OXA-GEN-CLI-TET-CIP-CHL 2285 - + -
Pyoderma PEN-GEN-CLI-TET-SXT-CHL 2769 - + -
Pyoderma PEN-OXA-GEN-CLI-TET-CIP-SXT 2227 - + -
Pyoderma PEN-CLI-TET-SXT-CHL NT - + -
Pyoderma PEN-OXA-CLI-TET-CIP-SXT-CHL 496 - - +
Pyoderma PEN-CLI-TET-SXT-CHL NT - + -
Pyoderma PEN-CLI-TET-CIP-SXT-CHL 1341 - + -
Pyoderma PEN-OXA-TET-CIP-SXT-CHL 794 - + -
Healthy PEN-CLI-TET-SXT-CHL 2769 - + - Healthy PEN-GEN-CLI-TET-CIP-SXT-CHL 25 - + -
S. epidermidis Healthy PEN-OXA 35 - - + (n = 5) Healthy PEN-OXA 5 - - +
Healthy PEN-OXA-GEN-TET 130 + - +
Healthy PEN-OXA-TET NT - - + Healthy PEN-OXA-GEN-TET 54 - - +
S. hominis Healthy PEN-FOX-TET-CIP-SXT NT + - - (n = 2) Healthy PEN-CHL NT - - +
S. capitis (n = 1) Healthy None ND + - + AMR, antimirobial resistance; PEN, Penicillin; OXA, oxacillin; FOX, cefoxitin; GEN, gentamicin; CLI, clindamycin; TET, tetracycline; CIP, ciprofloxacin; SXT, trimethoprim-sulfamethoxazole; CHL, chloramphenicol; ST, sequence type; None, no antimicrobial resistance detected; NT, non-typeable; ND, not determined; +, positive; -, negative.
Supplementary Table 1. Oligonucleotides sequence of primers used for PCR in this study Gene Forward primer (5’ to 3’) Reverse primer (5’ to 3’) Product size (bp) Reference pse TRGGCAGTAGGATTCGTTAA CTTTTGTGCTYCMTT TTGG 926 [21] qacA/B GCTGCATTTATGACAATGTTTG AATCCCACCTACTAAAGCAG 630 [30] smr ATAAGTACTGAAGTTATTGGAAGT TTCCGAAAATGTTTAACGAAACTA 286 [30] qacG CAACAGAAATAATCGGAACT TACATTTAAGAGCACTACA 275 [30]
Supplementary Table 2. Antimicrobial resistance profiles of 145 clinical and healthy skin staphylococcal isolates Group (n) Resistant isolates, n (%) PEN OXA FOX GEN CLI TET CIP SXT CHL Clinical isolates (128)
S. pseudintermedius (100) 97 (97.0) 70 (70.0) NA 28 (28.0) 55 (55.0) 88 (88.0) 52 (52.0) 66 (66.0) 48 (48.0) S. schleiferi (28) 10 (35.7) 13 (46.4) NA 0 (0) 0 (0) 0 (0) 15 (53.6) 0 (0) 0 (0) Healthy skin isolates (17)
S. pseudintermedius (6) 6 (100.0) 3 (50.0) NA 2 (33.3) 5 (83.3) 6 (100.0) 1 (16.7) 3 (50.0) 5 (83.3) S. epidermidis (5) 5 (100.0) 5 (100.0) 5 (100.0) 2 (40.0) 0 (0) 3 (60.0) 0 (0) 0 (0) 0 (0) S. hominis (3) 3 (100.0) NA 1 (33.3) 0 (0) 0 (0) 1 (33.3) 1 (33.3) 1 (33.3) 1 (33.3) S. schleiferi (1) 1 (100.0) 1 (100.0) NA 0 (0) 0 (0) 0 (0) 1 (100.0) 0 (0) 0 (0) S. capitis (1) 0 (0) NA 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) S. pettenkoferi (1) 0 (0) NA 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) Total (145) 122 (84.1) 92 (65.7)* 6 (60.0)* 32 (22.1) 60 (41.4) 98 (67.6) 70 (48.3) 70 (48.3) 54 (37.2)
PEN, penicillin; OXA, oxacillin; FOX, cefoxitin; GEN, gentamycin; CLI, clindamycin; TET, tetracyline; CIP, ciprofloxacin; SXT, trimethoprim-sulfamethoxazole; CHL, chloramphenicol.
Percentages in the Total row for OXA and FOX were calculated using the number of isolates for which the corresponding test was applicable (n = 140, n = 10, respectively).
* Methicillin resistance based on oxacillin or cefoxitin. Oxacillin disk diffusion results were interpreted for S. pseudintermedius, S. epidermidis, and S. schleiferi. For S. hominis, S. capitis, and S. pettenkoferi, methicillin resistance was interpreted using cefoxitin disk diffusion results according to CLSI criteria. NA, not applicable.